View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0719_high_15 (Length: 279)

Name: NF0719_high_15
Description: NF0719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0719_high_15
NF0719_high_15
[»] chr7 (1 HSPs)
chr7 (42-164)||(33388722-33388844)


Alignment Details
Target: chr7 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 42 - 164
Target Start/End: Complemental strand, 33388844 - 33388722
Alignment:
42 gaactctttcagaactgttgtgttaaaaaggtttgatctttgtgatcatgaactgcttctttctctgcttcaacagttcaatgcttgttctagcagcaac 141  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33388844 gaactctttcagaactgttgtgttaaaaaggtttgatctttgtgatcatgaactgcttctttctctgcttcaacagttcaatgcttgttctagcagcaac 33388745  T
142 tatagtgattcaattcaatccaa 164  Q
    |||||||||||||||||||||||    
33388744 tatagtgattcaattcaatccaa 33388722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University