View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0719_high_15 (Length: 279)
Name: NF0719_high_15
Description: NF0719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0719_high_15 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 42 - 164
Target Start/End: Complemental strand, 33388844 - 33388722
Alignment:
| Q |
42 |
gaactctttcagaactgttgtgttaaaaaggtttgatctttgtgatcatgaactgcttctttctctgcttcaacagttcaatgcttgttctagcagcaac |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33388844 |
gaactctttcagaactgttgtgttaaaaaggtttgatctttgtgatcatgaactgcttctttctctgcttcaacagttcaatgcttgttctagcagcaac |
33388745 |
T |
|
| Q |
142 |
tatagtgattcaattcaatccaa |
164 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
33388744 |
tatagtgattcaattcaatccaa |
33388722 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1064 times since January 2019
Visitors: 4402