View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0719_high_16 (Length: 277)
Name: NF0719_high_16
Description: NF0719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0719_high_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 30 - 261
Target Start/End: Complemental strand, 40415090 - 40414860
Alignment:
| Q |
30 |
tgtcgaggtctgcgacatagtaacagagcgcggtgctcgcctagtcggagctggaattgtatcaataatagaaaaagcgtagttacggttgaaggtggac |
129 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| | |||||||||||| || || |
|
|
| T |
40415090 |
tgtcgaggtctgcaacatagtaacagagcgcggtgctcgcctagtcgg-gctggaattgtatcaataatagaaaaagcatggttacggttgaaattgaac |
40414992 |
T |
|
| Q |
130 |
tttatgaacattataggattttcagaaattaccttcatagtagtgtatgggaaatgcttggcaatgatctttcggataatgtcattattgaacattctca |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40414991 |
tttatgaacattataggattttcagaaattaccttcatagtagtgtatgggaaatgctcggcaatgatctttcggataatgtcattattgaacattctca |
40414892 |
T |
|
| Q |
230 |
tggtggctctggatctggtgctctatttcttg |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
40414891 |
tggtggctctggatctggtgctctatttcttg |
40414860 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1548 times since January 2019
Visitors: 4422