View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0719_high_25 (Length: 246)

Name: NF0719_high_25
Description: NF0719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0719_high_25
NF0719_high_25
[»] chr3 (2 HSPs)
chr3 (17-127)||(11452286-11452396)
chr3 (190-246)||(11452168-11452224)


Alignment Details
Target: chr3 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 17 - 127
Target Start/End: Complemental strand, 11452396 - 11452286
Alignment:
17 catcatcaaagcctacgcacttcctcttcttctcttctctgctgccatgttctaccagctttttcttattcccaatgcttttcctccttctcattatgat 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11452396 catcatcaaagcctacgcacttcctcttcttctcttctctgctgccatgttctaccagctttttcttattcccaatgcttttcctccttctcattatgat 11452297  T
117 ggtaactagta 127  Q
    |||||||||||    
11452296 ggtaactagta 11452286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 190 - 246
Target Start/End: Complemental strand, 11452224 - 11452168
Alignment:
190 aatgcagttctgagaattaagatgtatagttcgattgatgaagtgaaggaggcttat 246  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
11452224 aatgcagttctgagaattaagatgtatagttcgattgatgaagtgaaggaagcttat 11452168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University