View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0719_high_7 (Length: 406)
Name: NF0719_high_7
Description: NF0719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0719_high_7 |
 |  |
|
[»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 397; Significance: 0; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 397; E-Value: 0
Query Start/End: Original strand, 2 - 406
Target Start/End: Complemental strand, 24229455 - 24229051
Alignment:
Q |
2 |
catcagcagcaaggttacgcagatcaacataattcgcaacggtgaggttgtagtcttctataagcttctcgatgtcggattcaattccgacgccgacgaa |
101 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
T |
24229455 |
catcagcagcaaggttacgcagatcaacataattcgcaacggtgaggttgtagtcttctataatcttctcgatgtcggattcaattccgacgccgacgaa |
24229356 |
T |
 |
Q |
102 |
tctgttgttagggttagagaggaaggtgaagaggaaagtggggatggagggggaatggatgagttggaatataagacagcggttgttggtgtagagttga |
201 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
24229355 |
tctgttgttagggttagagaggaaggtgaagaggaaagtggggatggagggggaatggatgagttggaatataagacagcggttgttggtgtagagttga |
24229256 |
T |
 |
Q |
202 |
agagtggcggctgggttggattggccgcgttgggagtttggacgccattcgatgtcaaggccgatgattgcgggggagagggattgggtttcgaggagcc |
301 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
24229255 |
agagtggcggctgggttggattggccgcgttgggagtttggacgccattcgatgtcaaggccgatgattgcgggggagagggattgggtttcgaggagcc |
24229156 |
T |
 |
Q |
302 |
aagattcgacgtggataggggaacaggtgaggagggtttggattgtgagggtggtgtcgatggtgatggagtaggtgttgtgggtgtcgtaggggaggtg |
401 |
Q |
|
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
24229155 |
aagattcgacgtggatgggggaacaggtgaggagggtttggattgtgagggtggtgtcgatggtgatggagtaggtgttgtgggtgtcgtaggggaggtg |
24229056 |
T |
 |
Q |
402 |
gttgt |
406 |
Q |
|
|
||||| |
|
|
T |
24229055 |
gttgt |
24229051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 333 - 406
Target Start/End: Original strand, 24225003 - 24225076
Alignment:
Q |
333 |
gagggtttggattgtgagggtggtgtcgatggtgatggagtaggtgttgtgggtgtcgtaggggaggtggttgt |
406 |
Q |
|
|
||||| ||||||||||| ||||| ||||| ||||||||||||||||| |||||| |||| ||||||| ||||| |
|
|
T |
24225003 |
gagggattggattgtgaaggtggagtcgaaggtgatggagtaggtgtcgtgggtatcgtgagggaggttgttgt |
24225076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 826 times since January 2019
Visitors: 4393