View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0719_low_20 (Length: 319)
Name: NF0719_low_20
Description: NF0719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0719_low_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 5173792 - 5173556
Alignment:
| Q |
1 |
cgatttacaacgataaataattatgtgcataggcttttgacatgttgttacttgtcattatcctatagctaaaaatgctgctttcaaatttaagtttata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5173792 |
cgatttacaacgataaataattatgtgcataggcttttgacatgttgttacttgtcattatcctatagctaaaaatgctgctttcaaatttaagtttata |
5173693 |
T |
 |
| Q |
101 |
aatgatctacaattgaagttcaaaaggttcgtcatcc-aaatttagtgacacaattgagacatcaaatctatttttatcattagaaatctaactcaataa |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5173692 |
aatgatctacaattgaagttcaaaaggttcgtcatccaaaatttagtgacacaattgagacatcaaatctatttttatcattagaaatctaactcaataa |
5173593 |
T |
 |
| Q |
200 |
cccggaatttgcaaacatggtagcacaagcaactgat |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5173592 |
cccggaatttgcaaacatggtagcacaagcaactgat |
5173556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University