View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0719_low_37 (Length: 264)
Name: NF0719_low_37
Description: NF0719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0719_low_37 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 177
Target Start/End: Complemental strand, 20670714 - 20670538
Alignment:
| Q |
1 |
gtttaatgtagaggaagatggtaagggttgttgagggatgaagagtgttaggctaagtgatggatgtgagattgataagatgcttacccatttgtttacg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| | |
|
|
| T |
20670714 |
gtttaatgtagaggaagatggtaagggttgttgaggaatgaagagtgttaggctaagtgatggatgggagattgataagatgcttacccatttgtttatg |
20670615 |
T |
 |
| Q |
101 |
cttgtgtctcctgatcctattagtgcatcaagaatgttgttcatttcttgcattgccaatggtggagttgatgatgt |
177 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20670614 |
cttgtgtctcctgatcctattagtgcatcaagaatgttgttcatttcttgcattgccaatggtggagttgatgatgt |
20670538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University