View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0719_low_44 (Length: 251)
Name: NF0719_low_44
Description: NF0719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0719_low_44 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 24 - 247
Target Start/End: Complemental strand, 40526985 - 40526762
Alignment:
Q |
24 |
atcagaaatagacttcaatttgaatccgacacatttaaacattgtttagatatggtgaaacagatccatacaatgcaaacttagcttaaatnnnnnnntg |
123 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| || |
|
|
T |
40526985 |
atcagaaatagacttcaatttgaatccgacacatttaaacattgtttagatatggtgaaacagaaccatacaatgcaaacttagcttaaataaaaaaatg |
40526886 |
T |
 |
Q |
124 |
acagatgcataatgcatttagccttcaccagctgttgactccaaaagcatcaggtatacataatgcatacacaactgactctaccatcaccacaaagcaa |
223 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40526885 |
acagatgcataatgcatttagccttcaccagctgttgactccaaaagcatcaggtatacataatgcatacacaactgactctaccatcaccacaaagcaa |
40526786 |
T |
 |
Q |
224 |
ctacctcaagttgacattttattc |
247 |
Q |
|
|
|| ||||||||||||||||||||| |
|
|
T |
40526785 |
ctccctcaagttgacattttattc |
40526762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1173 times since January 2019
Visitors: 4407