View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0719_low_45 (Length: 250)
Name: NF0719_low_45
Description: NF0719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0719_low_45 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 154 - 247
Target Start/End: Complemental strand, 10049246 - 10049153
Alignment:
| Q |
154 |
gattctatcattaatgcttggtgcgcataaaaactatagaaaattagcgaatgattattttaaaacttatgcatgtttattaattaatcatttc |
247 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10049246 |
gattctatcattaatgcttcgtgcgcataaaaactatagaaaattagcgaatgattattttaaaacttatgcatgtttattaattaatcatttc |
10049153 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 28 - 84
Target Start/End: Complemental strand, 10049372 - 10049316
Alignment:
| Q |
28 |
cagaaacttcgctatctcagtccaaatgtcgtcatcgaacattcattaagaattcag |
84 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
10049372 |
cagaaacttcgctatctcagtccaaatgtcgtcatcgaaccttcattaagaattcag |
10049316 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1715 times since January 2019
Visitors: 4429