View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0719_low_47 (Length: 246)
Name: NF0719_low_47
Description: NF0719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0719_low_47 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 17 - 127
Target Start/End: Complemental strand, 11452396 - 11452286
Alignment:
| Q |
17 |
catcatcaaagcctacgcacttcctcttcttctcttctctgctgccatgttctaccagctttttcttattcccaatgcttttcctccttctcattatgat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11452396 |
catcatcaaagcctacgcacttcctcttcttctcttctctgctgccatgttctaccagctttttcttattcccaatgcttttcctccttctcattatgat |
11452297 |
T |
 |
| Q |
117 |
ggtaactagta |
127 |
Q |
| |
|
||||||||||| |
|
|
| T |
11452296 |
ggtaactagta |
11452286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 190 - 246
Target Start/End: Complemental strand, 11452224 - 11452168
Alignment:
| Q |
190 |
aatgcagttctgagaattaagatgtatagttcgattgatgaagtgaaggaggcttat |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
11452224 |
aatgcagttctgagaattaagatgtatagttcgattgatgaagtgaaggaagcttat |
11452168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University