View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0719_low_50 (Length: 238)
Name: NF0719_low_50
Description: NF0719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0719_low_50 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 1 - 216
Target Start/End: Complemental strand, 17996102 - 17995894
Alignment:
| Q |
1 |
catattgaatgtatgaaggatattgatccagttcacaatagccatctagcttggtgttattcaatgttttcttcggttagaaggtggacacctcagttgg |
100 |
Q |
| |
|
||||||||| |||||||||||||||| || |||| ||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
17996102 |
catattgaaggtatgaaggatattgacccggttcgcaatagccatctagcttggtgatatt-------ttcttcggttagaaggtggacacctcagttgg |
17996010 |
T |
|
| Q |
101 |
tggcaaatagtagggcggtttggctccatgttcatggtattcccctccatgtttgggatgaacccttgttcaagaagattagctctttgtttggggtatt |
200 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| || |
|
|
| T |
17996009 |
tggcagatagtatggcggtttggctccatgttcatggtattcccctccatgtttgggatgaacccttgttcaagaagattgactctttgtttggggtgtt |
17995910 |
T |
|
| Q |
201 |
cttagattttgatgat |
216 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
17995909 |
cttagattttgatgat |
17995894 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 650 times since January 2019
Visitors: 4387