View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0719_low_52 (Length: 220)
Name: NF0719_low_52
Description: NF0719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0719_low_52 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 117; Significance: 9e-60; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 100 - 220
Target Start/End: Original strand, 47552330 - 47552450
Alignment:
| Q |
100 |
gaatctgtgtgatttaatagtaaggcacgtgctgttatatatgagttgtgcgttgtacaaaaacaaaaatataagagttttttcttcttcttatgaacag |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
47552330 |
gaatctgtgtgatttaatagtaaggcacgtgctgttatatatgagttgtgcgttgtacaaaaacaaaaatataagagttttatcttcttcttatgaacag |
47552429 |
T |
 |
| Q |
200 |
aaaaaatatgcgttagtgcgt |
220 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
47552430 |
aaaaaatatgcgttagtgcgt |
47552450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University