View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0719_low_53 (Length: 219)
Name: NF0719_low_53
Description: NF0719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0719_low_53 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 61 - 114
Target Start/End: Complemental strand, 42929654 - 42929601
Alignment:
| Q |
61 |
caaatgtaagaccaaccaataaatcaacaaaagcaccaacaatatagccatgat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42929654 |
caaatgtaagaccaaccaataaatcaacaaaagcaccaacaatatagccatgat |
42929601 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1205 times since January 2019
Visitors: 4407