View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0719_low_54 (Length: 219)
Name: NF0719_low_54
Description: NF0719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0719_low_54 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 107; Significance: 8e-54; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 107; E-Value: 8e-54
Query Start/End: Original strand, 1 - 111
Target Start/End: Original strand, 42929690 - 42929800
Alignment:
| Q |
1 |
tcgtcttctcgttctccttcttctcctttatcgttttatagttcttctttgtcttcctcttatagcactcgtcgtgtttcttgttcggaagctcgcgagg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
42929690 |
tcgtcttctcgttctccttcttctcctttatcgttttatagttcttctttgtcttcctcttatagcactcgttgtgtttcttgttcggaagctcgcgagg |
42929789 |
T |
|
| Q |
101 |
aagaggttgat |
111 |
Q |
| |
|
||||||||||| |
|
|
| T |
42929790 |
aagaggttgat |
42929800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 787 times since January 2019
Visitors: 4393