View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0719_low_56 (Length: 206)
Name: NF0719_low_56
Description: NF0719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0719_low_56 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 188
Target Start/End: Original strand, 34697124 - 34697312
Alignment:
| Q |
1 |
tgtgtcaaactctaaatttcctatagtcccttcttaaaaaacagaaggtttggacataatatatatcaatatttacatgtgtttgtgtgggcgcgtgtgc |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34697124 |
tgtgtcaaactctaaattacctatagtcccttcttaaaaaacagaaggtttggacaaaatatatatcaatatttacatgtgtttgtgtgggcgcccgtgc |
34697223 |
T |
 |
| Q |
101 |
gcacacccagaatgt-acgcacggggtatggttatgttctataatatctcatggacgtgtgcaatgttcatggcttcatttggttgatg |
188 |
Q |
| |
|
||||||||||||| | | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34697224 |
gcacacccagaatttaaagcacggggtatggttatgttctataatatctcatggacgtgtgcaatgttcatggcttcatttggttgatg |
34697312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University