View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0720-INSERTION-6 (Length: 261)
Name: NF0720-INSERTION-6
Description: NF0720
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0720-INSERTION-6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 139; Significance: 8e-73; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 8 - 166
Target Start/End: Original strand, 39590929 - 39591087
Alignment:
| Q |
8 |
aaatcacccctctataagcctgtttgaaattgtggtggatctccctcccactgcacgtctacaagaagcaacaattttgagcttcttaaaattcacgttt |
107 |
Q |
| |
|
||||||||| ||||||||||||||| ||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39590929 |
aaatcacccttctataagcctgtttaaaattgtggtggatctccctcccaccgcatgtctacaagaagcaacaattttgagcttcttaaaattcacgttt |
39591028 |
T |
 |
| Q |
108 |
aatatgcctaggacgcgataatatgttgctaaactccaatccaaacaaatactaaatcg |
166 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39591029 |
aatatgcttaggacgcgataatatgttgctaaactccaatccaaacaaatactaaatcg |
39591087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 64; Significance: 5e-28; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 24 - 134
Target Start/End: Original strand, 25931436 - 25931547
Alignment:
| Q |
24 |
agcctgtttgaaattgtggtggatctccctcccactgcacgtctacaagaagcaacaattttgagcttcttaaaattcacgtttaatatgccta-ggacg |
122 |
Q |
| |
|
|||||||||| |||| |||||||||||| ||||| |||| ||||||||||| ||||||||||||||||||||| |||||||| |||||||||| ||||| |
|
|
| T |
25931436 |
agcctgtttgggattgcggtggatctcccacccaccgcacttctacaagaagtaacaattttgagcttcttaaatttcacgttcaatatgcctagggacg |
25931535 |
T |
 |
| Q |
123 |
cgataatatgtt |
134 |
Q |
| |
|
| |||||||||| |
|
|
| T |
25931536 |
caataatatgtt |
25931547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 60 - 141
Target Start/End: Original strand, 34785779 - 34785861
Alignment:
| Q |
60 |
gcacgtctacaagaagcaacaattttgagcttcttaaaattcacgtttaatatgccta-ggacgcgataatatgttgctaaac |
141 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||| | |||| ||||||| |||||||||| ||||| || |||||||| |||||| |
|
|
| T |
34785779 |
gcacgtctacaagaagcagcaatttttagcttataaaaaatcacgttcaatatgcctagggacgtgagaatatgttactaaac |
34785861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University