View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0720-INSERTION-8 (Length: 313)
Name: NF0720-INSERTION-8
Description: NF0720
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0720-INSERTION-8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 181; Significance: 8e-98; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 181; E-Value: 8e-98
Query Start/End: Original strand, 116 - 312
Target Start/End: Original strand, 6148916 - 6149112
Alignment:
| Q |
116 |
caaacaaaccttgaacataatatacttagaggaaaacagaagggtgtatgtggggtgcgaagttaaagccctaaaaatattttgtctatttaaatttcct |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6148916 |
caaacaaaccttgaacataatatacttagaggaaaacagaagggtgtatgtggggtgtgaagttaaagccctaaaaatattttgtctatttaaatttcct |
6149015 |
T |
 |
| Q |
216 |
ttttacatattttctttccaagtagaacgagataagaacaaaggtacgagttaagttaggcaaacccttaattaaaataaattttgttaaagtatta |
312 |
Q |
| |
|
|||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6149016 |
ttttacattttttctttctaagtagaacgagataagaacaaaggtacgagttaagttagacaaacccttaattaaaataaattttgttaaagtatta |
6149112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 8 - 70
Target Start/End: Original strand, 6148808 - 6148870
Alignment:
| Q |
8 |
atggattggctttggcttttgggttgtggtgtatatgtgtatgtagaagtgaatacttttgtc |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6148808 |
atggattggctttggcttttgggttgtggtgtatatgtgtatgtagaagtgaatacttttgtc |
6148870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University