View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0720_low_7 (Length: 275)

Name: NF0720_low_7
Description: NF0720
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0720_low_7
NF0720_low_7
[»] chr7 (1 HSPs)
chr7 (1-112)||(37409112-37409223)


Alignment Details
Target: chr7 (Bit Score: 108; Significance: 3e-54; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 1 - 112
Target Start/End: Complemental strand, 37409223 - 37409112
Alignment:
1 ccgttactcacgagaaacaaactttccgttactataaaactcatcaaaacgttcttcttccattcttctccatttcccaatgaagatttctacattttct 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
37409223 ccgttactcacgagaaacaaactttccgttactataaaactcatcaaaacgttcttcttccattcttctccatttcccaatgaagatttccacattttct 37409124  T
101 atcattcttctc 112  Q
    ||||||||||||    
37409123 atcattcttctc 37409112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1273 times since January 2019
Visitors: 4365