View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0720_low_7 (Length: 275)
Name: NF0720_low_7
Description: NF0720
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0720_low_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 108; Significance: 3e-54; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 1 - 112
Target Start/End: Complemental strand, 37409223 - 37409112
Alignment:
Q |
1 |
ccgttactcacgagaaacaaactttccgttactataaaactcatcaaaacgttcttcttccattcttctccatttcccaatgaagatttctacattttct |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
37409223 |
ccgttactcacgagaaacaaactttccgttactataaaactcatcaaaacgttcttcttccattcttctccatttcccaatgaagatttccacattttct |
37409124 |
T |
 |
Q |
101 |
atcattcttctc |
112 |
Q |
|
|
|||||||||||| |
|
|
T |
37409123 |
atcattcttctc |
37409112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1273 times since January 2019
Visitors: 4365