View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0721_high_1 (Length: 489)
Name: NF0721_high_1
Description: NF0721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0721_high_1 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 400; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 400; E-Value: 0
Query Start/End: Original strand, 26 - 465
Target Start/End: Complemental strand, 19171605 - 19171166
Alignment:
Q |
26 |
atcaacagtaatatgactattaactctcactttaaacttatggtcccaccacaaaactctagcggtgccagcaatatcaacagccgcatcaagaaccatc |
125 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
T |
19171605 |
atcaacagtaatatgactattaactctcactttaaacttatggtcccaccacaaaactctagcggtgccagcaatatcaacagctgcatcaagaaccatc |
19171506 |
T |
 |
Q |
126 |
tcccttttcgctacgtcagacattactcggctcgcgtgtttcgcgagccgaagagctttaagccgagccggaagtctcagtaactgacatgacctcggtg |
225 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||| |
|
|
T |
19171505 |
tcccttttcgccacgtcagacattactcggctcgcgtgtttcgcgagccgaagagctttaagccgggcaggaagtctcagtaactgacatgacctcggtg |
19171406 |
T |
 |
Q |
226 |
gctgagacccggcttggaccggagctgaaccgaggagagaaccttcgtagaaaattgacatggttgttgatgagtagttaattggggctatgtttggatt |
325 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
T |
19171405 |
gctgagacccggcttggaccggagctgaaccgaggagagaaccttcgtagaaaattgacatggttgttgatgagtagttaattggagctatgtttggatt |
19171306 |
T |
 |
Q |
326 |
ggtgacatggacagttagaagaacttctgcgtctacaacggggaggcttggttttaaggaggtgaagttgatggagatgagatggaatgttgggtctttt |
425 |
Q |
|
|
|||||||||||| |||| |||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||| |
|
|
T |
19171305 |
ggtgacatggacggttaaaagaacttctgcgtctacgacggggaggcttggttttaaggaagtgaagttgatggagatgagatgaaatgttgggtctttt |
19171206 |
T |
 |
Q |
426 |
ggttttgctgagagaattgatgttgctgctactgctgatg |
465 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
T |
19171205 |
ggttttgctgagagaattgatgttgctgctactgctgatg |
19171166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 352 times since January 2019
Visitors: 4379