View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0721_high_5 (Length: 257)
Name: NF0721_high_5
Description: NF0721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0721_high_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 43 - 248
Target Start/End: Original strand, 19188003 - 19188208
Alignment:
| Q |
43 |
tgtttttgtttgagtgaatcgtttcacttgcttttaaaaattgtgannnnnnnactgtttttcaaaaggtgaatcatttcaatgatcaatgtgaattggt |
142 |
Q |
| |
|
||||||||||||||| |||| ||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19188003 |
tgtttttgtttgagtaaatcttttcatttgcttttaaaaattgtgatttttttactgtttttcaaaaggtgaatcatttcaatgatcaatgtgaattggt |
19188102 |
T |
|
| Q |
143 |
tcactgtctagagaaaaatagtgaattatttcagtcaattgaatgaatcgattcatttgctttcaaaaatgtgattttaggctaagcgaattgttttatt |
242 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||| ||| |
|
|
| T |
19188103 |
tcactgtctagagaaaaataatgaattatttcagtcaattgaatgaatcgattcatttactttcaaaaatgtgattttaggttaagcgaattgtttcatt |
19188202 |
T |
|
| Q |
243 |
gtatag |
248 |
Q |
| |
|
|||||| |
|
|
| T |
19188203 |
gtatag |
19188208 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 246 times since January 2019
Visitors: 4374