View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0721_high_6 (Length: 251)
Name: NF0721_high_6
Description: NF0721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0721_high_6 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 6 - 251
Target Start/End: Complemental strand, 19188589 - 19188344
Alignment:
| Q |
6 |
aggagcacagatggatctttgtcttggatccttgtattaaaagtcttcttgatggttccattcataataattgtggtgaatgtataggatgtcgaagatt |
105 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| | |
|
|
| T |
19188589 |
aggagcacaaatggatctttgtcttggatccttgtattaaaagtcttcttgatggttccattcataataattatggtgaatgtataggatgtcgaagact |
19188490 |
T |
 |
| Q |
106 |
ctcacacttgagaagaaaattgttgcattcaagtgtgagtagatagtccaacatctattatgaatgaaataattaatctatataagagaaatgatcccta |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19188489 |
ctcacacttgagaagaaaattgttgcattcaagtgtgagtagatagtccaacatctattatgaatgaaataattaatctatataagagaaatgatcccta |
19188390 |
T |
 |
| Q |
206 |
ttatcaatatcttacaattttggatcaacatggcgactctctcgct |
251 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19188389 |
tgatcaatatcttacaattttggatcaacatggcgactctctcgct |
19188344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University