View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0721_low_10 (Length: 257)

Name: NF0721_low_10
Description: NF0721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0721_low_10
NF0721_low_10
[»] chr5 (1 HSPs)
chr5 (43-248)||(19188003-19188208)


Alignment Details
Target: chr5 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 43 - 248
Target Start/End: Original strand, 19188003 - 19188208
Alignment:
43 tgtttttgtttgagtgaatcgtttcacttgcttttaaaaattgtgannnnnnnactgtttttcaaaaggtgaatcatttcaatgatcaatgtgaattggt 142  Q
    ||||||||||||||| |||| ||||| |||||||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||||||    
19188003 tgtttttgtttgagtaaatcttttcatttgcttttaaaaattgtgatttttttactgtttttcaaaaggtgaatcatttcaatgatcaatgtgaattggt 19188102  T
143 tcactgtctagagaaaaatagtgaattatttcagtcaattgaatgaatcgattcatttgctttcaaaaatgtgattttaggctaagcgaattgttttatt 242  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||| |||    
19188103 tcactgtctagagaaaaataatgaattatttcagtcaattgaatgaatcgattcatttactttcaaaaatgtgattttaggttaagcgaattgtttcatt 19188202  T
243 gtatag 248  Q
    ||||||    
19188203 gtatag 19188208  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 809 times since January 2019
Visitors: 4393