View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0721_low_10 (Length: 257)
Name: NF0721_low_10
Description: NF0721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0721_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 43 - 248
Target Start/End: Original strand, 19188003 - 19188208
Alignment:
Q |
43 |
tgtttttgtttgagtgaatcgtttcacttgcttttaaaaattgtgannnnnnnactgtttttcaaaaggtgaatcatttcaatgatcaatgtgaattggt |
142 |
Q |
|
|
||||||||||||||| |||| ||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
19188003 |
tgtttttgtttgagtaaatcttttcatttgcttttaaaaattgtgatttttttactgtttttcaaaaggtgaatcatttcaatgatcaatgtgaattggt |
19188102 |
T |
 |
Q |
143 |
tcactgtctagagaaaaatagtgaattatttcagtcaattgaatgaatcgattcatttgctttcaaaaatgtgattttaggctaagcgaattgttttatt |
242 |
Q |
|
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||| ||| |
|
|
T |
19188103 |
tcactgtctagagaaaaataatgaattatttcagtcaattgaatgaatcgattcatttactttcaaaaatgtgattttaggttaagcgaattgtttcatt |
19188202 |
T |
 |
Q |
243 |
gtatag |
248 |
Q |
|
|
|||||| |
|
|
T |
19188203 |
gtatag |
19188208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University