View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0721_low_6 (Length: 363)
Name: NF0721_low_6
Description: NF0721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0721_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 309; Significance: 1e-174; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 309; E-Value: 1e-174
Query Start/End: Original strand, 14 - 334
Target Start/End: Complemental strand, 52828637 - 52828317
Alignment:
Q |
14 |
atattaggaccaacgtatggtatctgattagtagttagtagaatagtactatagaaaagtgcttatttttgcacactgtttttaattagtcaatttatgc |
113 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
52828637 |
atattaggaccaacgtatggtatctgattagtagttagtacaatagtactatagaaaagtgcttatttttgcacactgtttttaattagtcaatttatgc |
52828538 |
T |
 |
Q |
114 |
attatagctggtttagtttgatattggatttcacgtggttggaggcatgttattattgttactattgtataagtgataagtgattggatctatctagttt |
213 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
52828537 |
attatagctggtttagtttgatattggatttcacgtggttggagacaagttattattgttactattgtataagtgataagtgattggatctatctagttt |
52828438 |
T |
 |
Q |
214 |
ggatggtagctacttatctttactatccgtctccactaagccaatagatcttgtaggatacgttcaatggagtcgtaggcttaaagaccaagcaattgta |
313 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
52828437 |
ggatggtagctacttatctttactatccgtctccactaagccaatagatcttgtaggatacgttcaatggagtcgtaggcttaaagaccaagcaattgta |
52828338 |
T |
 |
Q |
314 |
attcatacaatacgacacagg |
334 |
Q |
|
|
||||||||||||||||||||| |
|
|
T |
52828337 |
attcatacaatacgacacagg |
52828317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University