View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0721_low_9 (Length: 323)

Name: NF0721_low_9
Description: NF0721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0721_low_9
NF0721_low_9
[»] chr3 (1 HSPs)
chr3 (164-261)||(30476866-30476963)


Alignment Details
Target: chr3 (Bit Score: 82; Significance: 1e-38; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 164 - 261
Target Start/End: Original strand, 30476866 - 30476963
Alignment:
164 atagcactgatcctatttgagaatcttgatctatattccttgcgctatgatgtgtttctagtttagtgccttacttctgttgccttttttccgttcat 261  Q
    ||||||||||||||||||||||||||||||||||||| |||| |||| | ||||||||||||||||||||||||||||||||||||||||||||||||    
30476866 atagcactgatcctatttgagaatcttgatctatatttcttgtgctacggtgtgtttctagtttagtgccttacttctgttgccttttttccgttcat 30476963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University