View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0721_low_9 (Length: 323)
Name: NF0721_low_9
Description: NF0721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0721_low_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 82; Significance: 1e-38; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 164 - 261
Target Start/End: Original strand, 30476866 - 30476963
Alignment:
| Q |
164 |
atagcactgatcctatttgagaatcttgatctatattccttgcgctatgatgtgtttctagtttagtgccttacttctgttgccttttttccgttcat |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| |||| | |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30476866 |
atagcactgatcctatttgagaatcttgatctatatttcttgtgctacggtgtgtttctagtttagtgccttacttctgttgccttttttccgttcat |
30476963 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 502 times since January 2019
Visitors: 4385