View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0722_high_7 (Length: 251)
Name: NF0722_high_7
Description: NF0722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0722_high_7 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 3230665 - 3230444
Alignment:
| Q |
1 |
caacatctaatctatttgataggaaggctgtcattgttatatcatatgttgtaggatgctacaatggannnnnnnggtgatttttataaataaatgaaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||| |||| |||||||||||||||||||| |
|
|
| T |
3230665 |
caacatctaatctatttgataggaaggttgtcattgttatatcatatgttgtaggatgcttcaatggatttttttggtggtttttataaataaatgaaaa |
3230566 |
T |
|
| Q |
101 |
attggtaaaagtttcattaaaggacaatagttgctagttgcttccttactttcttcagatattcaataagaaggacaacttcagtgactataaagggtaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
3230565 |
attggtaaaagtttcattaaaggacaatagttgctagttgctaccttactttcttcagatattcaataaaaaggacaacttcagtaactataaagggtaa |
3230466 |
T |
|
| Q |
201 |
cgtaatgtttataactataatg |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
3230465 |
cgtaatgtttataactataatg |
3230444 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 775 times since January 2019
Visitors: 4393