View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0722_low_10 (Length: 316)
Name: NF0722_low_10
Description: NF0722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0722_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 211; Significance: 1e-115; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 2 - 224
Target Start/End: Original strand, 40518065 - 40518287
Alignment:
| Q |
2 |
tgcatctataaatactaatatctcgagttggatagagttataatataccatgaaaaattcctctcacgactagtagttaaatctggttccataactagtt |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40518065 |
tgcatctataaatactaatatctcgagttggatagagttataatatacgatgaaaaattcctctcacgactagtagttaaatctggttccataactagtt |
40518164 |
T |
 |
| Q |
102 |
aaaatagatgagacccgaactatcttatacaattgaaaattaaataatctaacgtgcgcatatatattgatgataatatgccaggatcatcccatgtccg |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40518165 |
aaaatagatgagacccgaactatcttatacaattgaaaattaaataatctaatgtgcgcatatatattgatgataatatgccaggatcatcccatgtccg |
40518264 |
T |
 |
| Q |
202 |
taatttctcccttgctagtttga |
224 |
Q |
| |
|
|||||| |||||||||||||||| |
|
|
| T |
40518265 |
taatttttcccttgctagtttga |
40518287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University