View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0722_low_13 (Length: 282)
Name: NF0722_low_13
Description: NF0722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0722_low_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 3e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 48 - 221
Target Start/End: Complemental strand, 37468244 - 37468071
Alignment:
| Q |
48 |
aatcgcgttttgataagtttccaagaaatctggaattacagttactgaagaagaagcaacggtgtttatatatggggttccttttcatgcatttctcgtg |
147 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37468244 |
aatcgcgttttgataagtttccaagaaatctggaattacagttaccgaagaagaagcaacggtgtttatatatggggttccttttcatgcatttctcgtg |
37468145 |
T |
|
| Q |
148 |
atgattggtaagaaacgttttcagccgttgattgagtgggttagtaatgtgatcgacggttgtgatgacgggaa |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37468144 |
atgattggtaagaaacgttttcagccgttgattgagtgggttagtaatgtgatcgacggttgtgatgacgggaa |
37468071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1062 times since January 2019
Visitors: 4402