View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0722_low_14 (Length: 269)
Name: NF0722_low_14
Description: NF0722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0722_low_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 50 - 238
Target Start/End: Complemental strand, 12018884 - 12018696
Alignment:
| Q |
50 |
catcattgtgttgactttcatatacattacaaaacatctaattcaatgtcatacaaacagnnnnnnnnnnnnnnnattatcaaattctttgtcttgattg |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
12018884 |
catcattgtgttgactttcatatacattacaaaacatctaattcaatgtcatacaaacagttttttgaattttttattatcaaattctttgtcttgattg |
12018785 |
T |
 |
| Q |
150 |
attagtttttgtacctaatgttgttcacattatatgagaaataaataactgtgttgtgttcaatcaattttcatatgctgctatttcat |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
12018784 |
attagtttttgtacctaatgttgttcacattatatgagaaataaataactgtgttgtgttcaatcaatttccatatgctgctatttcat |
12018696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University