View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0722_low_17 (Length: 251)

Name: NF0722_low_17
Description: NF0722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0722_low_17
NF0722_low_17
[»] chr6 (1 HSPs)
chr6 (1-222)||(3230444-3230665)


Alignment Details
Target: chr6 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 3230665 - 3230444
Alignment:
1 caacatctaatctatttgataggaaggctgtcattgttatatcatatgttgtaggatgctacaatggannnnnnnggtgatttttataaataaatgaaaa 100  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||       |||| ||||||||||||||||||||    
3230665 caacatctaatctatttgataggaaggttgtcattgttatatcatatgttgtaggatgcttcaatggatttttttggtggtttttataaataaatgaaaa 3230566  T
101 attggtaaaagtttcattaaaggacaatagttgctagttgcttccttactttcttcagatattcaataagaaggacaacttcagtgactataaagggtaa 200  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||    
3230565 attggtaaaagtttcattaaaggacaatagttgctagttgctaccttactttcttcagatattcaataaaaaggacaacttcagtaactataaagggtaa 3230466  T
201 cgtaatgtttataactataatg 222  Q
    ||||||||||||||||||||||    
3230465 cgtaatgtttataactataatg 3230444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 624 times since January 2019
Visitors: 4387