View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0722_low_8 (Length: 390)
Name: NF0722_low_8
Description: NF0722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0722_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 156; Significance: 9e-83; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 156; E-Value: 9e-83
Query Start/End: Original strand, 206 - 381
Target Start/End: Original strand, 37645224 - 37645398
Alignment:
Q |
206 |
atttttctctgcaatgattttaatagaaaggattgcaattttgttatcgtgataattgcaattgtgtaagagtatgagaaaatttgcaattgtcatcgta |
305 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
T |
37645224 |
atttttctctgcaatgattttaatagaaaggattgcaattttgttatcgtgataattgcaattgtgtgagagtatgagaaaatttgcaattgtcatcgta |
37645323 |
T |
 |
Q |
306 |
aaaattgcaggttgaggtattaatgttttcttttggttacttttgtgtacaaatttcctctcatacttagaattat |
381 |
Q |
|
|
||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||| |||| |
|
|
T |
37645324 |
aaaattgcaggttgaggtattaatgtttttttttggttacttttgtg-acaaatttcctctcatacttagatttat |
37645398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 89; E-Value: 8e-43
Query Start/End: Original strand, 30 - 159
Target Start/End: Original strand, 37644085 - 37644212
Alignment:
Q |
30 |
aagttgaaattgatataaaatgaagaaatacgagactttaaatgaagagatgataagttgtttttaatttttttgtcnnnnnnnnnnnngttgtttttaa |
129 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
T |
37644085 |
aagttgaaattgatataaaatgaagaaatacgagactttaaatgaagagatgataagttgtttttaatttttttgtc--aaaaaaaaaagttgtttttaa |
37644182 |
T |
 |
Q |
130 |
ttttcttcactacaacaacaccagtcttct |
159 |
Q |
|
|
|||||||||||||||||||||||||||||| |
|
|
T |
37644183 |
ttttcttcactacaacaacaccagtcttct |
37644212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 154 - 214
Target Start/End: Original strand, 37644342 - 37644402
Alignment:
Q |
154 |
tcttctggatgtattgagacttgggtaattgtgtgtctttagaggatatacaatttttctc |
214 |
Q |
|
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
37644342 |
tcttctggatgtattgagacttaggtaattgtgtgtctttagaggatatacaatttttctc |
37644402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University