View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0723_low_11 (Length: 251)

Name: NF0723_low_11
Description: NF0723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0723_low_11
NF0723_low_11
[»] chr1 (1 HSPs)
chr1 (1-242)||(50912533-50912770)


Alignment Details
Target: chr1 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 50912533 - 50912770
Alignment:
1 attaaatgagaaatgctagccatgccatctcatcgcactttttaacacactctaatcataattagccagtcatccacttattttagttaactcatttacc 100  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    ||||||||||||||    
50912533 attaaatgagaaatgctagccatgccatctcatcacactttttaacacactctaatcataattagccagtcatccacttatt----ttaactcatttacc 50912628  T
101 ggaaaccagaagtaaaatttgcaaaacaatttatttaacannnnnnnnaataatttgactgcaacttgtcgttgtccagtcatccaacgctggctttgag 200  Q
    ||||||||||||||||||||||||||||||||||||||||        ||||||||||||||||||||||||||||||||||||||||||||||||||||    
50912629 ggaaaccagaagtaaaatttgcaaaacaatttatttaacattttttttaataatttgactgcaacttgtcgttgtccagtcatccaacgctggctttgag 50912728  T
201 taaataactttgtccatggatatatgttttcttgattcatct 242  Q
    ||||||||||||||||||||||||||||||||||||||||||    
50912729 taaataactttgtccatggatatatgttttcttgattcatct 50912770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University