View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0723_low_11 (Length: 251)
Name: NF0723_low_11
Description: NF0723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0723_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 50912533 - 50912770
Alignment:
| Q |
1 |
attaaatgagaaatgctagccatgccatctcatcgcactttttaacacactctaatcataattagccagtcatccacttattttagttaactcatttacc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
50912533 |
attaaatgagaaatgctagccatgccatctcatcacactttttaacacactctaatcataattagccagtcatccacttatt----ttaactcatttacc |
50912628 |
T |
|
| Q |
101 |
ggaaaccagaagtaaaatttgcaaaacaatttatttaacannnnnnnnaataatttgactgcaacttgtcgttgtccagtcatccaacgctggctttgag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50912629 |
ggaaaccagaagtaaaatttgcaaaacaatttatttaacattttttttaataatttgactgcaacttgtcgttgtccagtcatccaacgctggctttgag |
50912728 |
T |
|
| Q |
201 |
taaataactttgtccatggatatatgttttcttgattcatct |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50912729 |
taaataactttgtccatggatatatgttttcttgattcatct |
50912770 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2801 times since January 2019
Visitors: 4801