View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0723_low_7 (Length: 269)
Name: NF0723_low_7
Description: NF0723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0723_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 25 - 251
Target Start/End: Complemental strand, 7590497 - 7590271
Alignment:
Q |
25 |
catcaaaccgccgtcaaccaccatcacacagctgctaaccaccaagataacaaccagcatgccgaacagcaagcaccagtaaccgtccccaaccattcaa |
124 |
Q |
|
|
||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7590497 |
catcaaaccgccgccaaccaccatcacacagctgctaaccaccaagataacagccagcatgccgaacagcaagcaccagtaaccgtccccaaccattcaa |
7590398 |
T |
 |
Q |
125 |
tttcacaaaacagaaacggtcaggaattaaatgttagtaatagtgaaggttctatttttaatggtgatgttattagcattagtgaaggataccaggagct |
224 |
Q |
|
|
|||||| ||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
7590397 |
tttcactaaacataaacggtaaggaattaaatgttagtaatagtgaaggttctatttttaatggtgatgttattagcattagtgaaggatcccaggagct |
7590298 |
T |
 |
Q |
225 |
acatggggattggctgctagtctcaag |
251 |
Q |
|
|
|||||| |||||||||||||||||||| |
|
|
T |
7590297 |
acatggtgattggctgctagtctcaag |
7590271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 25 - 251
Target Start/End: Complemental strand, 26711843 - 26711617
Alignment:
Q |
25 |
catcaaaccgccgtcaaccaccatcacacagctgctaaccaccaagataacaaccagcatgccgaacagcaagcaccagtaaccgtccccaaccattcaa |
124 |
Q |
|
|
||||||||||| || |||| ||||||||| || || ||||| ||||| |||| ||||| || || ||||||| ||||| |||||||| |||||||||| |
|
|
T |
26711843 |
catcaaaccgctgtgaacctccatcacaccgccgccaaccatcaagaaaacagccagcctgttgaccagcaagacccagtcaccgtccctaaccattcaa |
26711744 |
T |
 |
Q |
125 |
tttcacaaaacagaaacggtcaggaattaaatgttagtaatagtgaaggttctatttttaatggtgatgttattagcattagtgaaggataccaggagct |
224 |
Q |
|
|
|||||||||||| ||||||||| ||||||||||| | |||||| |||||||| ||||||||||| | |||||||| |||| |||||| ||||||||| |
|
|
T |
26711743 |
tttcacaaaacacaaacggtcaagaattaaatgtcattaatagcgaaggttccatttttaatggaggtgttattaccattgatgaaggtacccaggagct |
26711644 |
T |
 |
Q |
225 |
acatggggattggctgctagtctcaag |
251 |
Q |
|
|
||||||||||||||| || |||||||| |
|
|
T |
26711643 |
acatggggattggctccttgtctcaag |
26711617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2614 times since January 2019
Visitors: 4796