View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0723_low_8 (Length: 264)
Name: NF0723_low_8
Description: NF0723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0723_low_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 170; Significance: 3e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 1 - 178
Target Start/End: Original strand, 20670690 - 20670867
Alignment:
| Q |
1 |
cttaccatcttcctctacattaaaccccttcacttttccatatcatatcatccctcaacgtctcgtctacactgacctcctcctcctccctcgttactct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
20670690 |
cttaccatcttcctctacattaaaccccttcacttttccatatcatatcatccctcaacgtctcgtctacgctgacctcctcctcctccctcgttactct |
20670789 |
T |
|
| Q |
101 |
cgtatacctactcttctccccggtaaaaccatcaccgttaccgataacttccccggtaatttcacccttgatgatgtc |
178 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20670790 |
cgtatccctactcttctccccggtaaaaccatcaccgttaccgataacttccccggtaatttcacccttgatgatgtc |
20670867 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2700 times since January 2019
Visitors: 4796