View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0723_low_9 (Length: 257)
Name: NF0723_low_9
Description: NF0723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0723_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 5226175 - 5225938
Alignment:
| Q |
1 |
ttggtgtaaacttttatacatattgaaacctgaattttgaaatacacaagtttgtaaattttattgcagtaggtgtataatagtcttaaagagttggtta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5226175 |
ttggtgtaaacttttatacatattgaaacctgaattttgaaatacacaagtttgtaaattttattgcagtaggtgtataatagtcttaaagagttggtta |
5226076 |
T |
 |
| Q |
101 |
ctcaattgtaaattggaagagnnnnnnnnnnnnnnnttgcatcataaaatcacatccttaatttcggagtttggtcatgatagagattgttttgactttg |
200 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5226075 |
ctcaattgtaaattggaagagaaaaaattaaaaaaattgcatcataaaatcacatccttaatttcggagtttggtcatgatagagattgttttgactttg |
5225976 |
T |
 |
| Q |
201 |
atccaatttcattgcgggagcagcttaatgatgatgtc |
238 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5225975 |
atccaatttcattgtgggagcagcttaatgatgatgtc |
5225938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 141 - 233
Target Start/End: Complemental strand, 5189873 - 5189781
Alignment:
| Q |
141 |
atcataaaatcacatccttaatttcggagtttggtcatgatagagattgttttgactttgatccaatttcattgcgggagcagcttaatgatg |
233 |
Q |
| |
|
|||| |||||||||||||||||| | | | | ||||||| ||||||||||||| |||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
5189873 |
atcacaaaatcacatccttaattccatattacgatcatgatggagattgttttgaatttgatccaatttcattgtgggagcaacttaatgatg |
5189781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University