View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0724_high_5 (Length: 367)
Name: NF0724_high_5
Description: NF0724
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0724_high_5 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 348; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 348; E-Value: 0
Query Start/End: Original strand, 12 - 367
Target Start/End: Complemental strand, 32615086 - 32614731
Alignment:
| Q |
12 |
tatactcgtatctaatattttgaacattacttcgttttgtgaactaaactgtatgtgtttttgcgatccgtttgacagctgaagtagaagctttgacggt |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32615086 |
tatactcgtatctaatattttgaacattacttcgttttgtgaactgaactgtatgtgtttttgcgatccgtttgacagctgaagtagaagctttgacggt |
32614987 |
T |
|
| Q |
112 |
gcctgattcgtgcaagattcacgaaaaagtgaactcacagattttcaccggcatgatggcctttgtgatgggactcataaccatggtgagaatgacacga |
211 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32614986 |
gcctgattcatgcaagattcacgaaaaagtgaactcacagattttcaccggcatgatggcctttgtgatgggactcataaccatggtgagaatgacacga |
32614887 |
T |
|
| Q |
212 |
aacatgccgaagaggctcactgatgccaacttctactcaaattctgtttactctggtggtgactttaaaactgaagactctaatgaccaattgaccaacc |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32614886 |
aacatgccgaagaggctcactgatgccaacttctactcaaattctgtttactctggtggtgactttaaaactgaagactctaatgaccaattgaccaacc |
32614787 |
T |
|
| Q |
312 |
ctaccatttcggctcaagagtttatgactgttatgaagcgcatggctgagttggaa |
367 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32614786 |
ctaccatttcggctcaagagtttatgactgttatgaagcgcatggctgagttggaa |
32614731 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2757 times since January 2019
Visitors: 4801