View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0725_high_8 (Length: 251)
Name: NF0725_high_8
Description: NF0725
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0725_high_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 102; Significance: 9e-51; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 74 - 245
Target Start/End: Complemental strand, 50424893 - 50424724
Alignment:
| Q |
74 |
ctaattgaagcag-ggtctaacatgtctaacgagtaaagacacgacaagtaggggcgggaattggccgggtcgaaatagtttttgcttaaataggtcata |
172 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
50424893 |
ctaattgaagcagtggtctaacatgtctaa-gagtaaagacacgacaagtaggggcggaaattggccgggtcgaaatagtttttgcttaaataggttata |
50424795 |
T |
|
| Q |
173 |
cttagttgnnnnnnnnntaaaacataaatttgacttattagctcgtcaaagactttattttaagtataatcta |
245 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
50424794 |
cttagttgaagaaaaa--aaaacataaatttaacttattagttcgtcaaagactttattttaagtatgatcta |
50424724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2650 times since January 2019
Visitors: 4796