View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0725_low_11 (Length: 265)
Name: NF0725_low_11
Description: NF0725
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0725_low_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 10 - 237
Target Start/End: Complemental strand, 25377806 - 25377578
Alignment:
| Q |
10 |
gagatgaaattatgggaaaagagagatatataaaattggtcnnnnnnnnnn-gacaaaatataaattggtctttgtgatagataaataaagtttttgcat |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||| ||| |
|
|
| T |
25377806 |
gagatgaaattatgggaaaagagagatatataaaattggtctttttttttttgacaaaatataaattggtctttgtgatagataaatgaagtttttacat |
25377707 |
T |
|
| Q |
109 |
aaatgttttagtccttatnnnnnnnttgaaatcttactgttttctcaataatctttttctttaatatttagtcttcatgatagttatatgtaaaggaaat |
208 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25377706 |
aaatgttttagtccttataaaaaaattgaaatcttactgttttctcaataatttttttctttaatatttagtcttcatgatagttatatgtaaaggaaat |
25377607 |
T |
|
| Q |
209 |
tttaaaattcattattgaataaaatatat |
237 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
25377606 |
tttaaaattcattattgaataaaatatat |
25377578 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4046 times since January 2019
Visitors: 4825