View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0725_low_13 (Length: 251)
Name: NF0725_low_13
Description: NF0725
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0725_low_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 41350862 - 41351101
Alignment:
Q |
1 |
atctctcaatattctatggttagtgacttgattcttatgcattctatttgttttgtggactaatgaattgctatttgcagctaccctggaagtactccac |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
T |
41350862 |
atctctcaatattctatggttagtgacttgattcttatgcattctatttgttttgtggactaatgaattgctatttgcagctatcctggaagtactccac |
41350961 |
T |
 |
Q |
101 |
ttcatctagctgctagaggggggtctcttgattgcattcgtgaattgttggcatggggcgcagatcgtattcagcgtgattcatctgggtatggtttggt |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41350962 |
ttcatctagctgctagaggggggtctcttgattgcattcgtgaattgttggcatggggcgcagatcgtattcagcgtgattcatctgggtatggtttggt |
41351061 |
T |
 |
Q |
201 |
tttggatttgttaacatatctaaccatatttcatcttcat |
240 |
Q |
|
|
||||||||||||||||||||||||||| |||||||||||| |
|
|
T |
41351062 |
tttggatttgttaacatatctaaccatttttcatcttcat |
41351101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 91 - 191
Target Start/End: Original strand, 23713237 - 23713337
Alignment:
Q |
91 |
agtactccacttcatctagctgctagaggggggtctcttgattgcattcgtgaattgttggcatggggcgcagatcgtattcagcgtgattcatctgggt |
190 |
Q |
|
|
|||||||||||||||||||| |||| ||| || ||||| |||||||| || ||||| || |||||||| ||||||||| | || |||||| ||||||||| |
|
|
T |
23713237 |
agtactccacttcatctagcagctaaaggaggatctctcgattgcatccgcgaattattagcatggggtgcagatcgtctccaacgtgatgcatctgggt |
23713336 |
T |
 |
Q |
191 |
a |
191 |
Q |
|
|
| |
|
|
T |
23713337 |
a |
23713337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4012 times since January 2019
Visitors: 4825