View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0725_low_13 (Length: 251)

Name: NF0725_low_13
Description: NF0725
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0725_low_13
NF0725_low_13
[»] chr2 (1 HSPs)
chr2 (1-240)||(41350862-41351101)
[»] chr4 (1 HSPs)
chr4 (91-191)||(23713237-23713337)


Alignment Details
Target: chr2 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 41350862 - 41351101
Alignment:
1 atctctcaatattctatggttagtgacttgattcttatgcattctatttgttttgtggactaatgaattgctatttgcagctaccctggaagtactccac 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
41350862 atctctcaatattctatggttagtgacttgattcttatgcattctatttgttttgtggactaatgaattgctatttgcagctatcctggaagtactccac 41350961  T
101 ttcatctagctgctagaggggggtctcttgattgcattcgtgaattgttggcatggggcgcagatcgtattcagcgtgattcatctgggtatggtttggt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41350962 ttcatctagctgctagaggggggtctcttgattgcattcgtgaattgttggcatggggcgcagatcgtattcagcgtgattcatctgggtatggtttggt 41351061  T
201 tttggatttgttaacatatctaaccatatttcatcttcat 240  Q
    ||||||||||||||||||||||||||| ||||||||||||    
41351062 tttggatttgttaacatatctaaccatttttcatcttcat 41351101  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 91 - 191
Target Start/End: Original strand, 23713237 - 23713337
Alignment:
91 agtactccacttcatctagctgctagaggggggtctcttgattgcattcgtgaattgttggcatggggcgcagatcgtattcagcgtgattcatctgggt 190  Q
    |||||||||||||||||||| |||| ||| || ||||| |||||||| || ||||| || |||||||| ||||||||| | || |||||| |||||||||    
23713237 agtactccacttcatctagcagctaaaggaggatctctcgattgcatccgcgaattattagcatggggtgcagatcgtctccaacgtgatgcatctgggt 23713336  T
191 a 191  Q
    |    
23713337 a 23713337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 4012 times since January 2019
Visitors: 4825