View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0725_low_14 (Length: 251)
Name: NF0725_low_14
Description: NF0725
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0725_low_14 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 114; Significance: 6e-58; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 138 - 251
Target Start/End: Original strand, 41350669 - 41350782
Alignment:
| Q |
138 |
atgctatgttgttatggttttttaaatgttcttgaattggttgtaggggatttgttcggtttgtgaatgttagagatggaaagggtgcgacgccgttgca |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41350669 |
atgctatgttgttatggttttttaaatgttcttgaattggttgtaggggatttgttcggtttgtgaatgttagagatggaaagggtgcgacgccgttgca |
41350768 |
T |
 |
| Q |
238 |
tttggcatctcgac |
251 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
41350769 |
tttggcatctcgac |
41350782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 30 - 73
Target Start/End: Original strand, 41350555 - 41350598
Alignment:
| Q |
30 |
ccttaaagctattctttcttctgctcaatctagtcatgtggctg |
73 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41350555 |
ccttaaagctattctttcttctgctcaatctagtcatgtggctg |
41350598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University