View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0725_low_14 (Length: 251)

Name: NF0725_low_14
Description: NF0725
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0725_low_14
NF0725_low_14
[»] chr2 (2 HSPs)
chr2 (138-251)||(41350669-41350782)
chr2 (30-73)||(41350555-41350598)


Alignment Details
Target: chr2 (Bit Score: 114; Significance: 6e-58; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 138 - 251
Target Start/End: Original strand, 41350669 - 41350782
Alignment:
138 atgctatgttgttatggttttttaaatgttcttgaattggttgtaggggatttgttcggtttgtgaatgttagagatggaaagggtgcgacgccgttgca 237  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41350669 atgctatgttgttatggttttttaaatgttcttgaattggttgtaggggatttgttcggtttgtgaatgttagagatggaaagggtgcgacgccgttgca 41350768  T
238 tttggcatctcgac 251  Q
    ||||||||||||||    
41350769 tttggcatctcgac 41350782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 30 - 73
Target Start/End: Original strand, 41350555 - 41350598
Alignment:
30 ccttaaagctattctttcttctgctcaatctagtcatgtggctg 73  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
41350555 ccttaaagctattctttcttctgctcaatctagtcatgtggctg 41350598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 3793 times since January 2019
Visitors: 4821