View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0725_low_17 (Length: 251)
Name: NF0725_low_17
Description: NF0725
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0725_low_17 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 30 - 251
Target Start/End: Complemental strand, 50425138 - 50424916
Alignment:
| Q |
30 |
acaaacacgattgaaactcataaaaacagctgtgaatttttgaagtcaaaagaagattttgaatcttaaaacaacattgttttttgaaggaaatcttaaa |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
50425138 |
acaaacacgattgaaactcataaaaacagctgtgaatttttgaagtcaaaagaagattttgaatcttaaaatagcattgttttttgaaggaaatcttaaa |
50425039 |
T |
|
| Q |
130 |
atatcagtgttgttagtt-aattggattttttctagcacaaaatatttaacccagcacacggtatattttgtacgaaatagattttataggtactactaa |
228 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50425038 |
atatcagtgttgttagttgaattggattttttctagcacaaaatatttaacccagcacacggtatattttgtacgaaatagattttataggtactactaa |
50424939 |
T |
|
| Q |
229 |
tatttaacccattatttaattgt |
251 |
Q |
| |
|
||||||||||||||||| ||||| |
|
|
| T |
50424938 |
tatttaacccattatttcattgt |
50424916 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3286 times since January 2019
Visitors: 4812