View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0726-Insertion-5 (Length: 205)
Name: NF0726-Insertion-5
Description: NF0726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0726-Insertion-5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 165; Significance: 9e-89; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 165; E-Value: 9e-89
Query Start/End: Original strand, 7 - 204
Target Start/End: Original strand, 5038845 - 5039042
Alignment:
| Q |
7 |
actcaaaacagcacctgatcatttcctgctttcttactattggtataccaatcaacaggtatgataatggaaagattgttacatcatgtgactccttatt |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5038845 |
actcaaaacagcacctgatcatttcctgctttcttactattggtataccaatcaacatgtatgataatggaaagattgttacatcatgtgactccttatt |
5038944 |
T |
 |
| Q |
107 |
gtcttgtcattttgaatacagtagtttacttagcacggttttggnnnnnnngagaaaggcaattttctagtggcattggtaaaactttaaccatgccg |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
5038945 |
gtcttgtcattttgaatacagtagtttacttagcacggttttggaaaaaaagagaaaggcaattttctagtggcattggtaaaagtttagccatgccg |
5039042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University