View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0726_low_11 (Length: 318)
Name: NF0726_low_11
Description: NF0726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0726_low_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 1 - 301
Target Start/End: Original strand, 1769383 - 1769693
Alignment:
Q |
1 |
aatggtgaagttgttgctactgaatttttagcgtcggaagaagaagaatttgggacggttatcgatctgcgttggtggtgacgaggggggtgtggtattg |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1769383 |
aatggtgaagttgttgctactgaatttttagcgtcggaagaagaagaatttgggacggttatcgatctgcgttggtggtgacgaggggggtgtggtattg |
1769482 |
T |
 |
Q |
101 |
atagggagggtgtaaacccgattagggatgcggatattgcagacatgttttcgattc----------tatgttctgttctattgaatttatgttttgaat |
190 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
1769483 |
atagggagggtgtaaacccgattagggatgcggatattgcagacatgttttcgattctatgctatgttatgttctgttctattgaatttatgttttgaat |
1769582 |
T |
 |
Q |
191 |
atgatgatgatgatatttttacgtaactcgtggtggttgtttagtttgttattaattcagttatactttaacctcaatccttgtctatttattatcccta |
290 |
Q |
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
T |
1769583 |
acgatgatgatgatatttttacgtaactcgtggtggttgtttagtttgttattaattcagttatactttaaactcaatccttgtctatttattatcccta |
1769682 |
T |
 |
Q |
291 |
tcccctccacg |
301 |
Q |
|
|
||||||||||| |
|
|
T |
1769683 |
tcccctccacg |
1769693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University