View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0726_low_13 (Length: 297)
Name: NF0726_low_13
Description: NF0726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0726_low_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 154; Significance: 1e-81; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 55 - 246
Target Start/End: Complemental strand, 34041118 - 34040930
Alignment:
| Q |
55 |
gagatggacatcatccgagttgctcagaactacacccaaatctgcttgcgacctcccacagacctgccttactgaaagtgctatacattgacttcctttt |
154 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34041118 |
gagatagacataatccgagttgctcagaactacacccaaatctgcttgcaacctcccacagacctgccttactgaaagtgctatacattgacttcctttt |
34041019 |
T |
|
| Q |
155 |
tggccttctgtactgtccttcatcaacaccagcttcacctggtggaagatgcaagttgaacttggagtcaacatcgtcaacctccctctctg |
246 |
Q |
| |
|
||||||| ||||||||| ||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34041018 |
tggccttttgtactgtc---catcaacaccagcttcacctggtggaaaatgtaagttgaacttggagtcaacatcgtcaacctccctctctg |
34040930 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 55 - 246
Target Start/End: Original strand, 34585848 - 34586039
Alignment:
| Q |
55 |
gagatggacatcatccgagttgctcagaactacacccaaatctgcttgcgacctcccacagacctgccttactgaaagtgctatacattgacttcctttt |
154 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||| |||||||| ||||||||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
34585848 |
gagatagacataatccgagttgctcagaactacacccaaacctgcttgcaacctcccacaggcccgccttactgaaagtgctatacattgacttcctttt |
34585947 |
T |
|
| Q |
155 |
tggccttctgtactgtccttcatcaacaccagcttcacctggtggaagatgcaagttgaacttggagtcaacatcgtcaacctccctctctg |
246 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| ||||| | ||| | ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
34585948 |
cggccttttgtactgtccttcatcaacaccagcttcaccaggtgggaaatgtacattgaacttggaatcaacatcgtcaacctccctctctg |
34586039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4706 times since January 2019
Visitors: 4838