View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0726_low_17 (Length: 258)
Name: NF0726_low_17
Description: NF0726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0726_low_17 |
 |  |
|
[»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 30 - 258
Target Start/End: Complemental strand, 5038850 - 5038614
Alignment:
Q |
30 |
ttgagtattgcaaaatgtgcgggggagagtattacaggacttcctttcttcattttaggagtttgaaatgatagaagagaacagttttctttatcatcac |
129 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5038850 |
ttgagtattgcaaaatgtgcgggggagagtattacaggacttcctttcttcattttaggagtttgaaatgatagaagagaacagttttctttatcatcac |
5038751 |
T |
 |
Q |
130 |
ttcactcatcatagacttcttcaattcctttctcacatgaaatgaaaagaaaagaaaattgtt--------tcacaaagttggtatatgatcaaatcatt |
221 |
Q |
|
|
|| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||| |
|
|
T |
5038750 |
tttactcatcatagacttcttgaattcctttctcacatgaaatgaaaagaaaagaaaattgtttgacaaagtcacaaagctggtatatgatcaaatcatt |
5038651 |
T |
 |
Q |
222 |
aatcattaattatgagatgtatgtatggttttaaatt |
258 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| |
|
|
T |
5038650 |
aatcattaattatgagatgtatgtatggttttaaatt |
5038614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University