View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0726_low_18 (Length: 256)
Name: NF0726_low_18
Description: NF0726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0726_low_18 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 22 - 256
Target Start/End: Complemental strand, 37305924 - 37305690
Alignment:
| Q |
22 |
catcatcataggatttaggttttgcggtgttacaaccttgtcaatgcatgtagttagctatatctagattgtctcgagacaatctatatttcaaagtcag |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
37305924 |
catcatcataggatttaggttttgcggtgttacatcctcgtcaatgcatgtagttagctatatctagattgtcccgagacaatctatatttcaaggtcag |
37305825 |
T |
 |
| Q |
122 |
tattttaaatttaaacaaataaaattattgaaatttgaatcgttcgatcttgattgaatggtatagacttgactgattgtgcgcagacacattgcacaaa |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
37305824 |
tattttaaatttaaacaaataaaattattgaaatttgaatcgttcgatcttgattgaatggtatagacttgactgattgtgcgcagacaaattgcacaaa |
37305725 |
T |
 |
| Q |
222 |
atctaaatcatcgttattgggcagaataataacaa |
256 |
Q |
| |
|
|||| ||||||||| |||| |||||||||||||| |
|
|
| T |
37305724 |
atctgaatcatcgtcattgaccagaataataacaa |
37305690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University