View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0726_low_19 (Length: 254)
Name: NF0726_low_19
Description: NF0726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0726_low_19 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 25 - 254
Target Start/End: Original strand, 401459 - 401688
Alignment:
| Q |
25 |
catcatagaccaggtgcacagttcaaacctgtagaagtttaactaaagtagatcttgcttggctaatgcgcccactttttctgcaaagagaagcaaaatt |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
401459 |
catcatagaccaggtgcacagttcaaacctgtagaagtttaactaaagtagatcttgcttggctaatgcgcccactttttctgcaaagagaagcaaaatt |
401558 |
T |
 |
| Q |
125 |
gagccatgtttcaatgtcttcagctggtggcagcacaagtgttctaacagccaaaagtgcctgccaaacctgccaaaaagcatcacaaagtcagaggaag |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
401559 |
gagccatgtttcaatgtcttcagctggtggcagcacaagtgttctaacagccaaaagtgcctgccaaacctgccaaaaagcatcacaaagtcagaggaag |
401658 |
T |
 |
| Q |
225 |
ggaattaaaagcccaaatttgttaaatgtt |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
401659 |
ggaattaaaagcccaaatttgttaaatgtt |
401688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University