View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0727_high_19 (Length: 263)

Name: NF0727_high_19
Description: NF0727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0727_high_19
NF0727_high_19
[»] chr2 (2 HSPs)
chr2 (30-242)||(19377288-19377500)
chr2 (42-80)||(29564510-29564548)
[»] chr3 (1 HSPs)
chr3 (78-129)||(24971034-24971085)


Alignment Details
Target: chr2 (Bit Score: 201; Significance: 1e-110; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 30 - 242
Target Start/End: Original strand, 19377288 - 19377500
Alignment:
30 agaaataacacggttgatttgttaccggagtacaaggcatgggcttcgtttggtagcttcgccactgcttgaaagcaatatatctagtttataacattca 129  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||    
19377288 agaaataacacggttgatttgttaccggagtacaaggcatgggcttcgtttggtagcttcgccactgcgtgatagcaatatatctagtttataacattca 19377387  T
130 gaattctttctgaatttctttagaaatgtgtagctaaatactttttggttctctttctgaattctttctactaacacacagcagcagccaccgttatctt 229  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
19377388 gaattctttctgaatttctttagaaacgtgtagctaaatactttttggttctctttctgaattctttctactaacacacagcagcagccaccgttatctt 19377487  T
230 tcctcccctcccc 242  Q
    |||||||||||||    
19377488 tcctcccctcccc 19377500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 42 - 80
Target Start/End: Complemental strand, 29564548 - 29564510
Alignment:
42 gttgatttgttaccggagtacaaggcatgggcttcgttt 80  Q
    |||||| |||| |||||||||||||||||||||||||||    
29564548 gttgatctgttgccggagtacaaggcatgggcttcgttt 29564510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 78 - 129
Target Start/End: Complemental strand, 24971085 - 24971034
Alignment:
78 tttggtagcttcgccactgcttgaaagcaatatatctagtttataacattca 129  Q
    |||||||| | ||||||||| |||||||||||||||||||||||||||||||    
24971085 tttggtagttccgccactgcgtgaaagcaatatatctagtttataacattca 24971034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University