View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0727_high_23 (Length: 231)
Name: NF0727_high_23
Description: NF0727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0727_high_23 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 129; Significance: 6e-67; HSPs: 6)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 1 - 145
Target Start/End: Complemental strand, 11155761 - 11155617
Alignment:
Q |
1 |
caaatcaatattttaattcatgtttatgaaggtgagaggaaaatagctagggaaaacaacttgcttggaaaatttgttttggaaattcctccggctccgg |
100 |
Q |
|
|
||||| |||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
11155761 |
caaatgaatattctaattcatgtttatgaaggtgagaggaaaataactagggaaaacaacttgcttggaaaatttgttttggaaattcctccggctccgg |
11155662 |
T |
 |
Q |
101 |
caggtggtcctcagattaaaatcagcttccaaatcgatgatgatg |
145 |
Q |
|
|
|||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
11155661 |
caggtgttcctcagattaaaatcagcttccaaatcgatgatgatg |
11155617 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 1 - 145
Target Start/End: Complemental strand, 11196208 - 11196064
Alignment:
Q |
1 |
caaatcaatattttaattcatgtttatgaaggtgagaggaaaatagctagggaaaacaacttgcttggaaaatttgttttggaaattcctccggctccgg |
100 |
Q |
|
|
||||| |||||| ||||| |||||||||||||||||||||||||| ||||||| ||||||||||| |||| |||||| |||||||||||||| ||| ||| |
|
|
T |
11196208 |
caaatgaatattctaattgatgtttatgaaggtgagaggaaaataactagggacaacaacttgctaggaagatttgtgttggaaattcctcctgctgcgg |
11196109 |
T |
 |
Q |
101 |
caggtggtcctcagattaaaatcagcttccaaatcgatgatgatg |
145 |
Q |
|
|
|||||| ||||||||| | |||| |||||||||||||||| |||| |
|
|
T |
11196108 |
caggtgttcctcagatcataatccgcttccaaatcgatgacgatg |
11196064 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 1 - 105
Target Start/End: Complemental strand, 11132479 - 11132375
Alignment:
Q |
1 |
caaatcaatattttaattcatgtttatgaaggtgagaggaaaatagctagggaaaacaacttgcttggaaaatttgttttggaaattcctccggctccgg |
100 |
Q |
|
|
|||| ||||||||| ||||||||||| || ||||| || |||||| ||| || ||||||||||| ||||||||||||||||||||||| || ||||||| |
|
|
T |
11132479 |
caaaccaatattttgattcatgtttacgagggtgaaagaaaaataactatggggaacaacttgctaggaaaatttgttttggaaattcccccagctccgg |
11132380 |
T |
 |
Q |
101 |
caggt |
105 |
Q |
|
|
||||| |
|
|
T |
11132379 |
caggt |
11132375 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 11160623 - 11160566
Alignment:
Q |
1 |
caaatcaatattttaattcatgtttatgaaggtgagaggaaaatagctagggaaaaca |
58 |
Q |
|
|
||||| |||||| |||||||||||||||||||||||||||||||| |||||||||||| |
|
|
T |
11160623 |
caaatgaatattctaattcatgtttatgaaggtgagaggaaaataactagggaaaaca |
11160566 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 7 - 58
Target Start/End: Complemental strand, 11199198 - 11199147
Alignment:
Q |
7 |
aatattttaattcatgtttatgaaggtgagaggaaaatagctagggaaaaca |
58 |
Q |
|
|
|||||| |||||||||||||||||||||||||||||||| |||||||||||| |
|
|
T |
11199198 |
aatattctaattcatgtttatgaaggtgagaggaaaataactagggaaaaca |
11199147 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 16 - 65
Target Start/End: Complemental strand, 11170025 - 11169976
Alignment:
Q |
16 |
attcatgtttatgaaggtgagaggaaaatagctagggaaaacaacttgct |
65 |
Q |
|
|
|||||||||||||| ||||||||| ||||| ||| ||| ||||||||||| |
|
|
T |
11170025 |
attcatgtttatgagggtgagaggcaaataactaaggacaacaacttgct |
11169976 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 15 - 68
Target Start/End: Complemental strand, 12527978 - 12527925
Alignment:
Q |
15 |
aattcatgtttatgaaggtgagaggaaaatagctagggaaaacaacttgcttgg |
68 |
Q |
|
|
||||||||||||||| || ||||| | |||||||| ||||||||||||||||| |
|
|
T |
12527978 |
aattcatgtttatgagggcgagagaatgatagctagcgaaaacaacttgcttgg |
12527925 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University