View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0727_low_24 (Length: 338)
Name: NF0727_low_24
Description: NF0727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0727_low_24 |
 |  |
|
[»] chr3 (1 HSPs) |
 |  |
|
[»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 97 - 338
Target Start/End: Complemental strand, 830591 - 830347
Alignment:
Q |
97 |
acagttacatccaccacaaaaccttgatcataattatcttcttccctccctttcatttccacaacaacaac---tactcccatggccagcaccgaagaat |
193 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
830591 |
acagttacatccaccacaaaaccttgatcataattatcttcttccctccctttcatttccacaacaacaacaactactcccatggccagcaccgaagaat |
830492 |
T |
 |
Q |
194 |
ccctccgcaaatcccttcaatctcttccctctgctttttgctctgattctcgtgaagcatttcgtcaatccgttgttaatacacttgaacgtcgtctttt |
293 |
Q |
|
|
| ||||||||||||||||||||||||| |||||||| |||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
830491 |
ctctccgcaaatcccttcaatctcttctctctgcttccggctccgattctcgtgacgcatttcgtcaatccgttgttaatacacttgaacgtcgtctttt |
830392 |
T |
 |
Q |
294 |
ttacattccgtcgtttaaaatttactgcggtgtcgctggttttta |
338 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
830391 |
ttacattccgtcgtttaaaatttactgcggtgtcgctggttttta |
830347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 238 - 338
Target Start/End: Complemental strand, 941968 - 941868
Alignment:
Q |
238 |
gattctcgtgaagcatttcgtcaatccgttgttaatacacttgaacgtcgtcttttttacattccgtcgtttaaaatttactgcggtgtcgctggttttt |
337 |
Q |
|
|
||||| |||||||||||||||||||| ||| ||||| |||||||| ||| | ||||| ||||| |||||||| ||||| | ||||| |||||||||| |
|
|
T |
941968 |
gattcgcgtgaagcatttcgtcaatctgttaacaatacgcttgaacgccgtttgttttatattccttcgtttaagatttatcgtggtgttgctggttttt |
941869 |
T |
 |
Q |
338 |
a |
338 |
Q |
|
|
| |
|
|
T |
941868 |
a |
941868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University