View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0727_low_28 (Length: 320)
Name: NF0727_low_28
Description: NF0727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0727_low_28 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 96 - 307
Target Start/End: Original strand, 41658026 - 41658237
Alignment:
| Q |
96 |
atgtggaaatgtgaaatttcagaaatgtatatggacaaagtgagtttgtgaaattaaatgaagcatatgaatgagtagtttaactcgtcattttggaatc |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41658026 |
atgtggaaatgtgaaatttcagaaatgtatatggacaaagtgagtttgtgaaattaaatgaagcatatgaatgagtagtttaactcgtcattttggaatc |
41658125 |
T |
|
| Q |
196 |
tggatccctgctttcgcaatcacgtactatttgctgcgttcatgtaatccataccgatagattagaatcatacgattgacgtttttattttctaaattaa |
295 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
41658126 |
tggatccctgcgttcgcaatcacgtactatttgctgcgttcatgtaatccataccgctagattagaattatacgattgacgtttttattttctaaattaa |
41658225 |
T |
|
| Q |
296 |
attaaatgagaa |
307 |
Q |
| |
|
|||||||||||| |
|
|
| T |
41658226 |
attaaatgagaa |
41658237 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4091 times since January 2019
Visitors: 4827