View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0727_low_29 (Length: 317)
Name: NF0727_low_29
Description: NF0727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0727_low_29 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 155; Significance: 3e-82; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 73 - 227
Target Start/End: Complemental strand, 39865500 - 39865346
Alignment:
| Q |
73 |
tatactactacgtctacaacaaccaaagctttttcccactaggtgaaatcagctacatcctacatgtatcaaaaatgcctgccggagactgctaatatac |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39865500 |
tatactactacgtctacaacaaccaaagctttttcccactaggtgaaatcagctacatcctacatgtatcaaaaatgcctgccggagactgctaatatac |
39865401 |
T |
|
| Q |
173 |
tctcacttgtttagaatttcgatttgatctaactcaactctcatgctcaggactg |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39865400 |
tctcacttgtttagaatttcgatttgatctaactcaactctcatgctcaggactg |
39865346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3419 times since January 2019
Visitors: 4813